How to be a Breast Cancer Detective.

From Inside Cancer Wiki

(Difference between revisions)
Jump to: navigation, search
Line 30: Line 30:
'''During class'''
'''During class'''
 +
Part 1: Predicting the Breast cancer gene through Pedigree charts
 +
        Practice drawing a pedigree chart
 +
       
Begin by using PowerPoint presentation which contains links to other resources listed below:
Begin by using PowerPoint presentation which contains links to other resources listed below:
Mary Claire King: Finding brca1 and 2 by pedigree- http://www.dnai.org/media/a/king296¬04.swf
Mary Claire King: Finding brca1 and 2 by pedigree- http://www.dnai.org/media/a/king296¬04.swf
Mark Skolnick: Finding the breast cancer gene brca1-http://www.dnai.org/media/a/skolnick298_06.swf
Mark Skolnick: Finding the breast cancer gene brca1-http://www.dnai.org/media/a/skolnick298_06.swf
Mary Claire king: Can women be tested for breast cancer? http://www.dnaiorg/media/a/king295_08.swf
Mary Claire king: Can women be tested for breast cancer? http://www.dnaiorg/media/a/king295_08.swf
 +
 +
Part 2: Discussion of Biotechnology and bioinformatics based on reading [[Image:biotechnology.doc]]
 +
      Biotechnology’s Relation to Cancer Research
 +
Biotechnology has applied many of the techniques of cell biology,
 +
molecular biology, and protein chemistry to cancer research and treatment over
 +
the years. These developments include:the ability to create vaccines; the
 +
identification of protein markers for detecting and diagnosing cancers; the
 +
purification of interleukin and other immune-system enhancers; the preparation
 +
of bone marrow cells for transplants;the manipulation of natural
 +
products like taxol (from the Pacific yew tree) to make improved compounds that
 +
interfere with cell division. New diagnostic abilities and drugs will result
 +
from related advances in genomics, proteomics, computer modeling, and
 +
bioinformatics. Genomics (the study of the genes on the chromosomes) is
 +
showing the exact chromosomal defect involved in cancers and pinpointing how
 +
key genes malfunction. Proteomics (the study of the proteins made by the genes)
 +
will define the function of the protein made by the defective genes in the
 +
cascade of cancer events. Computer modeling allows proteins to be considered
 +
in a variety of new lights, including indentifying potential docking clefts for
 +
the introduction of small molecules or proteins that might interfere with cancer causing
 +
protein functions. Bioinformatics and combinatorial chemistry allow
 +
scientists to sort through molecules (both natural and synthetic) that
 +
interfere with cancer’s progress in a variety of ways. In addition, the ability
 +
to measure many different constituents (such as the DNA, RNA, and
 +
proteins) in both normal cells and cancer cells, will enable a more
 +
systemic genetic classification of cancer. Bioinformatics can discern
 +
patterns in those measurements to help better understand how cancer cells
 +
behave and how they react to different treatments.
 +
Fighting Cancer
 +
 +
        Finding the Brca 1 gene using bioinformatics
 +
     
'''Time required'''  
'''Time required'''  
-
Part 1-45 minutes
+
Part 1- 45 minutes
Part 2 -2 45 minute periods
Part 2 -2 45 minute periods
Line 92: Line 126:
'''Teacher Answer Key'''  
'''Teacher Answer Key'''  
-
Brca 1 genome:
+
Part 2: Bioinformatics  Brca 1 gene:
-
>C36A4.8 (brc-1 spliced coding region)
+
-
atggcagatgttgcactgaggatcacagaaacagtggcacgactgcaaaaagaactgaaatgtggaatttgctgttcaac
+
-
atacaaagatccaattctgtccacatgtttccatattttctgtcgttcttgcattaacgcttgcttcgaacgaaaacgaa
+
-
aagttcaatgcccaatttgtagaagtgtactggataagcgaagttgtcgagatacttatcaaattacaatggctgtgcag
+
-
aactatttaaagctatcagaagcatttaaaaaagatattgagaatatgaatacgttcaagtcactgccgccagagaaaat
+
-
gttcatggaaagtcaaatgccgctggatatcacgattattccagagaatgatggaaaacgatgcgctccagattttgcta
+
-
taccttttttgccagtgcgccgaaagcgaccgagtcgaccacaaccgccgagcgcattcgccgaggagcctgcagaaccg
+
-
gtagaaccgccagaaccagccacaaaacaacctgtagagctccaaagtcgagtattcccgctggaaaaattgaaaaaaga
+
-
cgtggaaacctctacagaaacgtataaaatatcaagagaagaactgaaaaatgttgatattgaagaatacataaataccc
+
-
tccgagaaaattcgacagagattgatgaaatcgatgcacttttccaattaatgccgacgatgcgacaatttcttcgaaat
+
-
aatatcaatcagctaatggagaaattccatgtggcgccaccgaaaaaatcagagaaaccagcgaatcgaagagtatcctt
+
-
tgcgagttctcaagatcttgaaaacataaaaattatgacagcttctgaatcgctggaaactcctcctgagccaatccaaa
+
-
aactagcccaaaagcctgaagttttcaaaagtactcaaaatttgatcgatttgaatctaaatactgcagtgaaaaagcca
+
-
gtggtcgtagcatcagatgatgatgaagttgtagaagattctgaaggagaactacaaattgatgaagatgatctggcaaa
+
-
tgttacctgtgctacaagtgtaagaaatataggaaaatcattgtgtgcagaatatatcagggaaggccgttcaatttctc
+
-
aaaaatccacagcatatctctatgcaattgctcgaaaatgcgttattgtaggacgtcaatggcttgtagattgtataaca
+
-
acgggtcttttactgtctgaggcagactacacgataacgtcatgttcttcaacaattcctgtaaaaataccaccgtcaat
+
-
tggctccgaaatgggatggctcagatcgagaaacgatgaacatggaaaattatttgcgggacgacgattcatgattctca
+
-
ggaaatttacgatgaatccgtattttgattataagcaactaatcgagcttgtccaacaatgcggaggagaaattctgagt
+
-
tgctacgagaatctgtcacctgaaaaactctacataatcttctcaaaacactcaaaagcaattgaagaatcaaaaaatat
+
-
cgagaatctgtataaatgtgatgtggtgacaatggaatgggtattggacagtatcagtgaatatttaattctacccactc
+
-
aaccttacaaagctgtcgattcgataggctgcctgcaggattaa
+
-
Brca 1 human breast cancer genome:
+
Questions
 +
1.What is a locus?  A position in the genome where a particular gene is found
 +
2.How many “bp” base pairs are found in this locus? 3759 base pairs
 +
3.Where is the gene found? mRNA Homo Sapiens
 +
4.What does the gene encode for?
 +
            This gene encodes a nuclear phosphoprotein that plays a
 +
            role in maintaining genomic stability and acts as a tumor
 +
            suppressor. The encoded protein combines with other tumor
 +
            suppressors, DNA damage sensors, and signal transducers to form a
 +
            large multi-subunit protein complex known as BASC for
 +
            BRCA1-associated genome surveillance complex. This gene product
 +
            associates with RNA polymerase II, and through the C-terminal
 +
            domain, also interacts with histone deacetylase complex. This
 +
            protein thus plays a role in transcription, DNA repair of
 +
            double-stranded breaks, and recombination. Mutations in this gene
 +
            are responsible for approximately 40% of inherited breast cancers
 +
            and more than 80% of inherited breast and ovarian cancers.
 +
            Alternative splicing plays a role in modulating the subcellular
 +
            localization and physiological function of this gene. Many
 +
            alternatively spliced transcript variants have been described for
 +
            this gene but only some have had their full-length natures
 +
            identified.

Revision as of 19:21, 29 July 2008

How to be a Breast Cancer Detective.

Lesson Overview

Briefly describe the lesson here.

The lesson begins with interpreting familial pedigree charts and continues with steps in the identification of the genes responsible for some breast cancers. It continues with gene analysis and identification of the mutations through bioinformatics techniques.


Goals and Objectives 1) understand the process by which genes of parents are transferred to their offspring. 2) understand the difference between a dominant and recessive trait and understand how the presence of a trait may effect the physical characteristics of an individual. 3) read and/or construct a pedigree chart mapping a specific trait in a family. 4) determine the probability of a certain phenotype being expressed in an individual. 5) learn techniques of searching for specific genes in databases. 6) using bioinformatics technology to compare normal and mutated genes

Common Misconceptions

Describe any common misconceptions this lesson may address



The Lesson

Preparation Before class: (materials, handouts etc.) Part 1. Introduction to Pedigree charts (handout)Highlighters, pens, pencils, books, chalkboard, and 1 computer with LCD projector and sound system Part 2: Computer classroom; one computer per student, LCD projector,sound system

During class Part 1: Predicting the Breast cancer gene through Pedigree charts

       Practice drawing a pedigree chart
       

Begin by using PowerPoint presentation which contains links to other resources listed below: Mary Claire King: Finding brca1 and 2 by pedigree- http://www.dnai.org/media/a/king296¬04.swf Mark Skolnick: Finding the breast cancer gene brca1-http://www.dnai.org/media/a/skolnick298_06.swf Mary Claire king: Can women be tested for breast cancer? http://www.dnaiorg/media/a/king295_08.swf

Part 2: Discussion of Biotechnology and bioinformatics based on reading Image:Biotechnology.doc

      Biotechnology’s Relation to Cancer Research 

Biotechnology has applied many of the techniques of cell biology, molecular biology, and protein chemistry to cancer research and treatment over the years. These developments include:the ability to create vaccines; the identification of protein markers for detecting and diagnosing cancers; the purification of interleukin and other immune-system enhancers; the preparation of bone marrow cells for transplants;the manipulation of natural products like taxol (from the Pacific yew tree) to make improved compounds that interfere with cell division. New diagnostic abilities and drugs will result from related advances in genomics, proteomics, computer modeling, and bioinformatics. Genomics (the study of the genes on the chromosomes) is showing the exact chromosomal defect involved in cancers and pinpointing how key genes malfunction. Proteomics (the study of the proteins made by the genes) will define the function of the protein made by the defective genes in the cascade of cancer events. Computer modeling allows proteins to be considered in a variety of new lights, including indentifying potential docking clefts for the introduction of small molecules or proteins that might interfere with cancer causing protein functions. Bioinformatics and combinatorial chemistry allow scientists to sort through molecules (both natural and synthetic) that interfere with cancer’s progress in a variety of ways. In addition, the ability to measure many different constituents (such as the DNA, RNA, and proteins) in both normal cells and cancer cells, will enable a more systemic genetic classification of cancer. Bioinformatics can discern patterns in those measurements to help better understand how cancer cells behave and how they react to different treatments. Fighting Cancer

       Finding the Brca 1 gene using bioinformatics
      


Time required

Part 1- 45 minutes Part 2 -2 45 minute periods

Student Handouts for the Lesson Plan

Describe any handouts and provide links to documents that include the handouts. Remember to upload the handouts to the wiki before linking to them.

Alternative Assessments

Describe any alternative activities or assessments you may have developed.

Suggestions for Extended Learning

• Webster K Cavenee and Raymond L. White, “The Genetic Basis of Cancer,” Scientific American, March 1995. • Robert Cooke, Dr. Folkman’s War: Angiogenesis and the Struggle to Defeat Cancer • Jerome Groopman, “The Thirty Years’ War,” The New Yorker (June 4, 2001) • Matt Ridley, Chapter 17 in Genome: Autobiography of a Species in 23 Chapters • Robert Weinberg, One Renegade Cell • Lisa Yount, Cancer • Time and Newsweek cover articles on cancer topics • American Cancer Society: http://www.cancer.org • National Cancer Institute: http://www.nci.nih.gov • National Childhood Cancer Foundation: http://www.nccf.org • Oncolink: http://www.oncolink.upenn.edu • NOVA’s program on Judah Folkman, Cancer Warrior: http://pbs.org/wgbh/ nova/cancer


Glossary Allele—an alternate form of a gene. Chromosome—structure in the cell nucleus that stores and transmits genetic information. Gene—unit of heredity. Genotype—Allelic status of an organism for a genetic trait. Heterozygous—having different alleles of a gene. Homozygous—having indistinguishable alleles of a gene. Pedigree—diagram showing the expression of a specific characteristic and the biological relationships among members of a family, often of several generations. Phenotype—the observable organism, the expression of a genetic trait. Bioinformatics- NCBI- ClustalW- Brca 1 and 2-genes when mutated may cause breast cancer in humans



Education Standards

Please align your lesson plan with any education standards that apply.

Teacher Answer Key Part 2: Bioinformatics Brca 1 gene:

Questions 1.What is a locus? A position in the genome where a particular gene is found 2.How many “bp” base pairs are found in this locus? 3759 base pairs 3.Where is the gene found? mRNA Homo Sapiens 4.What does the gene encode for?

           This gene encodes a nuclear phosphoprotein that plays a
           role in maintaining genomic stability and acts as a tumor
           suppressor. The encoded protein combines with other tumor
           suppressors, DNA damage sensors, and signal transducers to form a
           large multi-subunit protein complex known as BASC for
           BRCA1-associated genome surveillance complex. This gene product
           associates with RNA polymerase II, and through the C-terminal
           domain, also interacts with histone deacetylase complex. This
           protein thus plays a role in transcription, DNA repair of
           double-stranded breaks, and recombination. Mutations in this gene
           are responsible for approximately 40% of inherited breast cancers
           and more than 80% of inherited breast and ovarian cancers.
           Alternative splicing plays a role in modulating the subcellular
           localization and physiological function of this gene. Many
           alternatively spliced transcript variants have been described for
           this gene but only some have had their full-length natures
           identified.
Personal tools