How to be a Breast Cancer Detective.
From Inside Cancer Wiki
| Line 78: | Line 78: | ||
Pedigree—diagram showing the expression of a specific characteristic and the biological relationships among members of a family, often of several generations. | Pedigree—diagram showing the expression of a specific characteristic and the biological relationships among members of a family, often of several generations. | ||
Phenotype—the observable organism, the expression of a genetic trait. | Phenotype—the observable organism, the expression of a genetic trait. | ||
| + | Bioinformatics- | ||
| + | NCBI- | ||
| + | ClustalW- | ||
| + | Brca 1 and 2-genes when mutated may cause breast cancer in humans | ||
| Line 88: | Line 92: | ||
'''Teacher Answer Key''' | '''Teacher Answer Key''' | ||
| + | Brca 1 genome: | ||
| + | >C36A4.8 (brc-1 spliced coding region) | ||
| + | atggcagatgttgcactgaggatcacagaaacagtggcacgactgcaaaaagaactgaaatgtggaatttgctgttcaac | ||
| + | atacaaagatccaattctgtccacatgtttccatattttctgtcgttcttgcattaacgcttgcttcgaacgaaaacgaa | ||
| + | aagttcaatgcccaatttgtagaagtgtactggataagcgaagttgtcgagatacttatcaaattacaatggctgtgcag | ||
| + | aactatttaaagctatcagaagcatttaaaaaagatattgagaatatgaatacgttcaagtcactgccgccagagaaaat | ||
| + | gttcatggaaagtcaaatgccgctggatatcacgattattccagagaatgatggaaaacgatgcgctccagattttgcta | ||
| + | taccttttttgccagtgcgccgaaagcgaccgagtcgaccacaaccgccgagcgcattcgccgaggagcctgcagaaccg | ||
| + | gtagaaccgccagaaccagccacaaaacaacctgtagagctccaaagtcgagtattcccgctggaaaaattgaaaaaaga | ||
| + | cgtggaaacctctacagaaacgtataaaatatcaagagaagaactgaaaaatgttgatattgaagaatacataaataccc | ||
| + | tccgagaaaattcgacagagattgatgaaatcgatgcacttttccaattaatgccgacgatgcgacaatttcttcgaaat | ||
| + | aatatcaatcagctaatggagaaattccatgtggcgccaccgaaaaaatcagagaaaccagcgaatcgaagagtatcctt | ||
| + | tgcgagttctcaagatcttgaaaacataaaaattatgacagcttctgaatcgctggaaactcctcctgagccaatccaaa | ||
| + | aactagcccaaaagcctgaagttttcaaaagtactcaaaatttgatcgatttgaatctaaatactgcagtgaaaaagcca | ||
| + | gtggtcgtagcatcagatgatgatgaagttgtagaagattctgaaggagaactacaaattgatgaagatgatctggcaaa | ||
| + | tgttacctgtgctacaagtgtaagaaatataggaaaatcattgtgtgcagaatatatcagggaaggccgttcaatttctc | ||
| + | aaaaatccacagcatatctctatgcaattgctcgaaaatgcgttattgtaggacgtcaatggcttgtagattgtataaca | ||
| + | acgggtcttttactgtctgaggcagactacacgataacgtcatgttcttcaacaattcctgtaaaaataccaccgtcaat | ||
| + | tggctccgaaatgggatggctcagatcgagaaacgatgaacatggaaaattatttgcgggacgacgattcatgattctca | ||
| + | ggaaatttacgatgaatccgtattttgattataagcaactaatcgagcttgtccaacaatgcggaggagaaattctgagt | ||
| + | tgctacgagaatctgtcacctgaaaaactctacataatcttctcaaaacactcaaaagcaattgaagaatcaaaaaatat | ||
| + | cgagaatctgtataaatgtgatgtggtgacaatggaatgggtattggacagtatcagtgaatatttaattctacccactc | ||
| + | aaccttacaaagctgtcgattcgataggctgcctgcaggattaa | ||
| - | + | Brca 1 human breast cancer genome: | |
Revision as of 17:27, 29 July 2008
How to be a Breast Cancer Detective.
Lesson Overview
Briefly describe the lesson here.
The lesson begins with interpreting familial pedigree charts and continues with steps in the identification of the genes responsible for some breast cancers. It continues with gene analysis and identification of the mutations through bioinformatics techniques.
Goals and Objectives 1) understand the process by which genes of parents are transferred to their offspring. 2) understand the difference between a dominant and recessive trait and understand how the presence of a trait may effect the physical characteristics of an individual. 3) read and/or construct a pedigree chart mapping a specific trait in a family. 4) determine the probability of a certain phenotype being expressed in an individual. 5) learn techniques of searching for specific genes in databases. 6) using bioinformatics technology to compare normal and mutated genes
Common Misconceptions
Describe any common misconceptions this lesson may address
The Lesson
Preparation Before class: (materials, handouts etc.) Part 1. Introduction to Pedigree charts (handout)Highlighters, pens, pencils, books, chalkboard, and 1 computer with LCD projector and sound system Part 2: Computer classroom; one computer per student, LCD projector,sound system
During class Begin by using PowerPoint presentation which contains links to other resources listed below: Mary Claire King: Finding brca1 and 2 by pedigree- http://www.dnai.org/media/a/king296¬04.swf Mark Skolnick: Finding the breast cancer gene brca1-http://www.dnai.org/media/a/skolnick298_06.swf Mary Claire king: Can women be tested for breast cancer? http://www.dnaiorg/media/a/king295_08.swf
Time required
Part 1-45 minutes Part 2 -2 45 minute periods
Student Handouts for the Lesson Plan
Describe any handouts and provide links to documents that include the handouts. Remember to upload the handouts to the wiki before linking to them.
Alternative Assessments
Describe any alternative activities or assessments you may have developed.
Suggestions for Extended Learning
• Webster K Cavenee and Raymond L. White, “The Genetic Basis of Cancer,” Scientific American, March 1995. • Robert Cooke, Dr. Folkman’s War: Angiogenesis and the Struggle to Defeat Cancer • Jerome Groopman, “The Thirty Years’ War,” The New Yorker (June 4, 2001) • Matt Ridley, Chapter 17 in Genome: Autobiography of a Species in 23 Chapters • Robert Weinberg, One Renegade Cell • Lisa Yount, Cancer • Time and Newsweek cover articles on cancer topics • American Cancer Society: http://www.cancer.org • National Cancer Institute: http://www.nci.nih.gov • National Childhood Cancer Foundation: http://www.nccf.org • Oncolink: http://www.oncolink.upenn.edu • NOVA’s program on Judah Folkman, Cancer Warrior: http://pbs.org/wgbh/ nova/cancer
Glossary Allele—an alternate form of a gene. Chromosome—structure in the cell nucleus that stores and transmits genetic information. Gene—unit of heredity. Genotype—Allelic status of an organism for a genetic trait. Heterozygous—having different alleles of a gene. Homozygous—having indistinguishable alleles of a gene. Pedigree—diagram showing the expression of a specific characteristic and the biological relationships among members of a family, often of several generations. Phenotype—the observable organism, the expression of a genetic trait. Bioinformatics- NCBI- ClustalW- Brca 1 and 2-genes when mutated may cause breast cancer in humans
Education Standards
Please align your lesson plan with any education standards that apply.
Teacher Answer Key Brca 1 genome: >C36A4.8 (brc-1 spliced coding region) atggcagatgttgcactgaggatcacagaaacagtggcacgactgcaaaaagaactgaaatgtggaatttgctgttcaac atacaaagatccaattctgtccacatgtttccatattttctgtcgttcttgcattaacgcttgcttcgaacgaaaacgaa aagttcaatgcccaatttgtagaagtgtactggataagcgaagttgtcgagatacttatcaaattacaatggctgtgcag aactatttaaagctatcagaagcatttaaaaaagatattgagaatatgaatacgttcaagtcactgccgccagagaaaat gttcatggaaagtcaaatgccgctggatatcacgattattccagagaatgatggaaaacgatgcgctccagattttgcta taccttttttgccagtgcgccgaaagcgaccgagtcgaccacaaccgccgagcgcattcgccgaggagcctgcagaaccg gtagaaccgccagaaccagccacaaaacaacctgtagagctccaaagtcgagtattcccgctggaaaaattgaaaaaaga cgtggaaacctctacagaaacgtataaaatatcaagagaagaactgaaaaatgttgatattgaagaatacataaataccc tccgagaaaattcgacagagattgatgaaatcgatgcacttttccaattaatgccgacgatgcgacaatttcttcgaaat aatatcaatcagctaatggagaaattccatgtggcgccaccgaaaaaatcagagaaaccagcgaatcgaagagtatcctt tgcgagttctcaagatcttgaaaacataaaaattatgacagcttctgaatcgctggaaactcctcctgagccaatccaaa aactagcccaaaagcctgaagttttcaaaagtactcaaaatttgatcgatttgaatctaaatactgcagtgaaaaagcca gtggtcgtagcatcagatgatgatgaagttgtagaagattctgaaggagaactacaaattgatgaagatgatctggcaaa tgttacctgtgctacaagtgtaagaaatataggaaaatcattgtgtgcagaatatatcagggaaggccgttcaatttctc aaaaatccacagcatatctctatgcaattgctcgaaaatgcgttattgtaggacgtcaatggcttgtagattgtataaca acgggtcttttactgtctgaggcagactacacgataacgtcatgttcttcaacaattcctgtaaaaataccaccgtcaat tggctccgaaatgggatggctcagatcgagaaacgatgaacatggaaaattatttgcgggacgacgattcatgattctca ggaaatttacgatgaatccgtattttgattataagcaactaatcgagcttgtccaacaatgcggaggagaaattctgagt tgctacgagaatctgtcacctgaaaaactctacataatcttctcaaaacactcaaaagcaattgaagaatcaaaaaatat cgagaatctgtataaatgtgatgtggtgacaatggaatgggtattggacagtatcagtgaatatttaattctacccactc aaccttacaaagctgtcgattcgataggctgcctgcaggattaa
Brca 1 human breast cancer genome:
